1. write an equvialent expression: -1/2 (-2x + 4y)
2. Factor to write an equivalent expression: 26a - 10.

Answers

Answer 1

Answer:

Step-by-step explanation:

I've answered this question already.


Related Questions

Evaluate the given expression for x=5

Evaluate the given expression for x=5

Answers

x² + 3x - 2

(5)² + 3 × 5- 2

25 + 15 - 2

40 - 2

38...

The Earth is approximately a sphere of diameter 12742 km. The surface area of a sphere is given by the formula A = 4π r2 Calculate the surface area of the Earth. Give your answer in metres squared and in standard form. Answer ………………………….

Answers

Answer:

Don't know....

follow me and mark me brainliest

For f(x)=3x -1 and g(x) = x+2 find (f-g)

Answers

Answer:

(f - g) = 2x - 3

Step-by-step explanation:

Simply distribute the negative and add like terms together:

(f - g) = 3x - 1 - (x + 2)

(f - g) = 3x - 1 - x - 2

(f - g) = 2x -  3

K A hot-air balloon is rising vertically. The angle of elevation from a point on level ground 126 feet from the balloon to a point directly under the passenger compartment changes from 19.3 deg to 32.3 deg How far, to the nearest tenth of a foot, does the balloon rise during this period?

Answers

The increase in height (rise) of the balloon is \(35.53 feet\)

What is Pythagorean Theorem?

Pythagoras' theorem states that "the square of the hypotenuse side in a right-angled triangle is equal to the sum of the squares of the other two sides."

The angle of elevation is generated by the intersection of the horizontal line and the line of sight. If the line of sight is directed upward from the horizontal line, the resulting angle is an angle of elevation.

According to the given information:

Given that,

Initial angle of elevation = \(19.3^{0}\).

Final angle of elevation = \(32.3^{0}\).

Distance = \(126 feet\).

How to calculate the height (rise).

In order to determine the increase in height (rise) of the balloon, we would apply Pythagorean Theorem. Mathematically, this is given by this formula:

tan∅ = \(\frac{height}{adj}\)

height = adjacent \(*\) tan∅

At an initial angle of elevation:

height \(=126* tan 19.3^{0} \\= 126 * 0.3501\\= 44.11 feet\)

At a final angle of elevation:

height \(=126* tan 32.3^{0} \\= 126* 0.6321\\= 79.64 feet\)

For the change in height:

Δh \(= 79.64-44.11\\=35.53 feet\)

Learn  more about Pythagorean Theorem here: brainly.com/question/16176867

#SPJ1

Help me, Please. I need an answer.

Help me, Please. I need an answer.

Answers

Answer:

1/4 x 4/1 x4/1= 2

6/1 x 6/1 x1/6=2

Step-by-step explanation:

Need this question answered

Need this question answered

Answers

Answer:

Answer is D or since there is no letters the last answer

Step-by-step explanation:

A side of the triangle below has been extended to form an exterior angle of 74°. Find the value of x.​

A side of the triangle below has been extended to form an exterior angle of 74. Find the value of x.

Answers

Answer:

Step-by-step explanation:

The adjacent angle to the missing angle must sum to 180 degrees. So a=180-74=106 degrees. The sum of the three angles of the triangle must also sum to 180.

x+49+106=180

x+155=180

x=25

Answer:

106

Step-by-step explanation:

x+49=74

x=74-49=25

y=74=180

y=180-74=106

im sorry im late if u see this yw!

Which graph represents a line with a slope of and a y-intercept equal to that of the line y = x – 2? A coordinate plane with a line starting at (negative 2, negative 4), passing through (0, negative 2) and (2, 1). A coordinate plane with a line passing through (negative 3, 0) and (0, 2). A coordinate plane with a line passing through (0, 2) and (2, negative 1). A coordinate plane with a line passing through (negative 3, 0) and (0, negative 2). Mark this and return

Answers

The first option is the correct one for the line y = x - 2:

" coordinate plane with a line starting at (negative 2, negative 4), passing through (0, negative 2)"

Which is the graph of the line?

Here we want to identify the graph of the linear equation:

y = x - 2

First, notice that when we evaluate this in x = 0 we get the y-intercept:

y = 0 - 2

y = -2

Then the y-intercept there is (0, -2)

Also, evaluating the linear equation in x = -2, then we will get:

y = -2 - 2

y = -4

So we have the point (-2, -4)

Then the correct option is the first one:

" coordinate plane with a line starting at (negative 2, negative 4), passing through (0, negative 2)"

Learn more about linear equations at:

https://brainly.com/question/1884491

#SPJ1

Translate to an equation please.

four less than thirteen times a number is equal to that number added to eight

Answers

Hi 

let call "a number" X.

then we have: 4-13X = X + 8 ..

13x-4 = x+8
13x-x = 8+ 4
12x= 12
X= 1

Find the equation of the line:Through :(1, 4), slope=9

Answers

We know that the line passes through (1,4) and it has a slope of 9.

We use the point-slope formula.

\(y-y_1=m(x-x_1)\)

Where,

\(\begin{gathered} x_1=1 \\ y_1=4 \\ m=9 \end{gathered}\)

Replacing these values, we have

\(\begin{gathered} y-4=9(x-1) \\ y-4=9x-9 \\ y=9x-9+4 \\ y=9x-5 \end{gathered}\)Therefore, the equation is y = 9x - 5.

answer the following...

answer the following...

Answers

It’s asking for which of the following will not prove that “l” is parallel to “n”... With this information we can choose an equation that has nothing to do with one of the line... giving us...
A) Angle one plus Angle four is equal to 180

Hope this helped!

RATS is a parallelogram. M

Answers

Answer:

Answer:

x = 12

Step-by-step explanation:

m∠S + m∠T = 180

8x + 7x = 180

15x = 180

x = 12

does this help?

25 POINTS Simplify the expression. 9 + 2(4 + 10) – 3(6 + 5) answer right and I will give brainiest

Answers

121

Step-by-step explanation:

9+2=11

4+10=14

11×14=154

6+5=11

3×11=33

154-33=121

Answer:

Step-by-step explanation:

9 + 2(14) - 3(11)

9 + 28 - 33

37 - 33 = 4

Mr.khatiwada. is a unmarried secondary level mathematics teacher in a community school.His monthly salary is Rs 39990with Rs 2000 allowance and gets one months basic salary as festival expense.if 10%and next 13%of his basic salary is deposited in his provident fund and civil investment trust respectively,how much income tax should he pay in this year.​

Answers

The income tax that will be paid for the year will be RS 4199.

How to calculate the tax?

The total income that the ma gets will be:

= 39990 + 2000

= 41990

The tax rate is given as 10%. Therefore, the income tax that will be paid this year will be:

= 10% × 41990

= 4199

Learn more about tax on:

brainly.com/question/25783927

#SPJ1


Find the first four terms of the sequence given by the following.
Gr
an = 43-6(n-1), n=1, 2, 3...

Answers

Answer:

43-6, (n-1), n=1, (2,3)

Step-by-step explanation:

Find the value of x when 5 - x = 12x + 4

Answers

Answer:

5-4=12x+x

1=13x

1/13=×

Helpppp pls!!! This is due in a few minsss :(

Helpppp pls!!! This is due in a few minsss :(

Answers

Step-by-step explanation:

no . he should have gotten 3 raise to the 9th power

What is the equivalent to the product below when x>_0?
√5x² •√15x²

Answers

To simplify the product √(5x²) • √(15x²) when x ≥ 0, we can combine the square roots and simplify the expression.

√(5x²) • √(15x²) = √(5x² * 15x²)

Using the property of square roots that √(a * b) = √a * √b, we can simplify further:

√(5x² * 15x²) = √(5 * 15 * x² * x²)

Next, we simplify the numerical part:

√(5 * 15 * x² * x²) = √(75 * x² * x²)

Since x ≥ 0, x² is always non-negative, so we can remove the square root:

√(75 * x² * x²) = x * x * √75

Finally, we simplify the square root of 75:

x * x * √75 = x² * √75

Therefore, the equivalent expression is x² * √75 when x ≥ 0.

Find the area of the parallelogram in the coordinate plane.
A (7,5)
D(-9,-2)
Units
B(6,5)
C(4-2)

Answers

To find the area of a parallelogram in the coordinate plane, we need to determine the base and the height of the parallelogram.

Using the given coordinates, we can find the length of one side of the parallelogram as the distance between points A and B.

The length of AB = sqrt((6 - 7)^2 + (5 - 5)^2) = sqrt((-1)^2 + 0^2) = sqrt(1) = 1

The height of the parallelogram can be found as the distance between point D and the line passing through points A and B. We can use the formula for the distance between a point and a line to find the perpendicular distance.

The equation of the line passing through A and B can be found using the point-slope form:

y - 5 = (5 - 5)/(7 - 6) * (x - 7)

y - 5 = 0 * (x - 7)

y - 5 = 0

y = 5

The perpendicular distance from point D(-9, -2) to the line y = 5 is the difference in their y-coordinates:

Perpendicular distance = |-2 - 5| = 7

Now, we have the base length AB = 1 and the height = 7.

The area of the parallelogram is given by the formula: Area = base * height.

Area = 1 * 7 = 7 square units.

Check the picture below.

\(\textit{area of a trapezoid}\\\\ A=\cfrac{h(a+b)}{2}~~ \begin{cases} h~~=height\\ a,b=\stackrel{parallel~sides}{bases~\hfill }\\[-0.5em] \hrulefill\\ a=1\\ b=13\\ h=7 \end{cases}\implies A=\cfrac{7(1+13)}{2}\implies A=49\)

Find the area of the parallelogram in the coordinate plane.A (7,5)D(-9,-2)UnitsB(6,5)C(4-2)

by rounding each number to 1 significant figure, estimate the answer to 23.4 x 13.9 /0.18 Thanks

Answers

Answer:

1000

Step-by-step explanation:

23.4 to 1 sf gives 20

13.9 to 1 sf gives 10

0.18 to 1 sf gives 0.2

Therefore it becomes 20 × 10 ÷ 0.2 = 200 ÷ 0.2 = 1000

Two functions g and f are defined in the figure below.

Two functions g and f are defined in the figure below.

Answers

The domain of fog is: Domain of fog = {x ∈ R | 3 ≤ g(x) ≤ 9}

The range of fog is:  Range of fog = {1, 2, 5}

What is domain and range?

The domain of a function is the set of all possible input values (usually denoted by x) for which the function is defined.

The range of a function is the set of all possible output values (usually denoted by y) that the function can produce for its corresponding inputs in the domain.

(a) Domain of fog:

The domain of fog is the set of all inputs for which the composition is defined. Since g is defined for all values in its domain, and f is defined for all values in the range of g, the domain of fog is the set of all values in the domain of g for which g(x) is in the domain of f.

(b) Range of fog:

The range of fog is the set of all possible outputs of the composition. Since g is defined for all values in its domain, and f is defined for all values in the range of g, the range of fog is the set of all possible outputs of f when its input is an output of g.

Range of fog = {f(g(x)) | x ∈ R, 3 ≤ g(x) ≤ 9}

To determine the values in the range of fog, we need to evaluate f(g(x)) for each x in the domain of fog. We can do this by first determining the outputs of g for each value in its domain, and then evaluating f at those outputs.

The outputs of g for x = 4, 5, 7 are:

g(4) = 6

g(5) = 8

g(7) = 9

Since f is defined for all values in the range of g, we can evaluate f at each of these outputs to get:

f(g(4)) = f(6) = 5

f(g(5)) = f(8) = 2

f(g(7)) = f(9) = 1

To know more about function visit:

https://brainly.com/question/29120892

#SPJ1

The complex fifth roots of 5-5sqrt3i

Answers

The required fifth roots of the given complex number as ⁵√3i = ⁵√3·⁵√i.

What is a complex number?

A complex number is a combination of real values and imaginary values. It is denoted by z = a + ib,

where a, and b are real numbers and i is an imaginary number.

The complex number is given in the question following as

3i

We have to determine the fifth roots of the given complex

As per the given question, we have

⇒ ⁵√3i

Apply the radical rule ⁿ√ab = ⁿ√aⁿ·√b,  (Assuming a ≥ 0, b ≥ 0)

⇒ ⁵√3·⁵√i

Thus, the required fifth roots of the given complex number as ⁵√3i = ⁵√3·⁵√i.

Learn more about the complex numbers here:

brainly.com/question/19007885

#SPJ1

HELP ILL GIVE YOU THE BRAINLIEST

HELP ILL GIVE YOU THE BRAINLIEST

Answers

Answer:

there are 20 seeds per packet

is that your question?

An artist recreated a famous painting using a 6:1 scale. The dimensions of the scaled painting are 24 inches by 36 inches. What are the dimensions of the actual painting?

4 inches by 6 inches
18 inches by 30 inches
30 inches by 42 inches
144 inches by 216 inches

Answers

By using scale and prοpοrtiοn, the dimensiοns οf the actual painting are 144 inches² by 216 inches².

What are the scale and prοpοrtiοn?

Scale refers tο the relatiοnship between the dimensiοns οf a scaled οbject and the cοrrespοnding dimensiοns οf the οriginal οbject. If an οbject is scaled dοwn tο half its οriginal size, then the dimensiοns οf the scaled οbject will be half οf the dimensiοns οf the οriginal οbject.

Prοpοrtiοn, οn the οther hand, refers tο the relatiοnship between twο οr mοre quantities that have the same ratiο. In οther wοrds, if twο quantities are in prοpοrtiοn, then their ratiο is cοnstant.

Tο find the dimensiοns οf the actual painting, we need tο "undο" the 6:1 scale.

If the scaled painting is 6 times smaller than the actual painting, then the actual painting is 6 times larger than the scaled painting.

Sο we can find the actual dimensiοns by multiplying the scaled dimensiοns by 6:

Actual width = 24 inches x 6 = 144 inches

Actual height = 36 inches x 6 = 216 inches

Therefοre, the dimensiοns οf the actual painting are 144 inches² by 216 inches².

To know more about scale and proportion visit:

brainly.com/question/21882232

#SPJ1

Find the quotient of 3/5 3/7. Write your answer in the simplest form.

Answers

\(\cfrac{3}{5}\div\cfrac{3}{7}\implies \cfrac{~~\begin{matrix} 3 \\[-0.7em]\cline{1-1}\\[-5pt]\end{matrix}~~}{5}\cdot \cfrac{7}{~~\begin{matrix} 3 \\[-0.7em]\cline{1-1}\\[-5pt]\end{matrix}~~}\implies \cfrac{7}{5}\implies 1\frac{2}{5}\)

Daniela is making bracelets and has 30 purple beads and 18 blue beads. She wants to make identical bracelets. What is the greatest number of bracelets she can make?

Answers

Answer:

I think its 12.

Step-by-step explanation:

Answer:

4 braclets

Step-by-step explanation:

what is the missing term

13, ?, 208

Answers

Answer:

159???????

Step-by-step explanation:

find the inverse of each function

find the inverse of each function

Answers

Answer:

c

Step-by-step explanation:

assume base 10

-logy = x

\( \frac{1}{ log(y) } = x\)

log base x y = 5 turns into the format x^ 5 = y

implement that to get c

Find the quotient. Express the final result using positive integer exponents only (72x^-1 y^4)^-1 / (8x^8y^3)

Answers

ANSWER:

\(\frac{1}{576x^7y^7}\)

STEP-BY-STEP EXPLANATION:

We have the following function:

\(\frac{\left(72x^{-1}y^4\right)^{-1}}{8x^8y^3}\)

We operate to simplify and we are left with the following:

\(\frac{72^{-1}x^{-1\cdot-1}y^{4\cdot-1}}{8x^8y^3}=\frac{\frac{1}{72}xy^{-4}}{8x^8y^3}=\frac{1}{72\cdot8\cdot x^8\cdot x^{-1}\cdot y^3\cdot y^4}=\frac{1}{576x^7y^7}\)

A tank in the shape of a hemisphere has a diameter of 24 feet. If the liquid that fills the tank has a density of 92.5 pounds per cubic foot, what is the total weight of the liquid in the tank, to the nearest full pound?

Answers

The total weight of the liquid in the tank is approximately 12,628 pounds.

To calculate the weight of the liquid, we need to determine the volume of the hemisphere and then multiply it by the density of the liquid. The formula for the volume of a hemisphere is V = (2/3)πr³, where r is the radius of the hemisphere.

In this case, the diameter of the tank is given as 24 feet, so the radius is half of that, which is 12 feet. Plugging this value into the formula, we get V = (2/3)π(12)³ ≈ 904.78 cubic feet.

Finally, we multiply the volume by the density of the liquid: 904.78 cubic feet * 92.5 pounds per cubic foot ≈ 12,628 pounds. Therefore, the total weight of the liquid in the tank is approximately 12,628 pounds.

In summary, to calculate the weight of the liquid in the tank, we first determine the volume of the hemisphere using the formula V = (2/3)πr³. Then, we multiply the volume by the density of the liquid.

By substituting the given diameter of 24 feet and using the appropriate conversions, we find that the total weight of the liquid is approximately 12,628 pounds.

for such more questions on  weight

https://brainly.com/question/29892643

#SPJ8

Other Questions
refers to the period of time before writing was invented. The perimeter of a rectangle is 130 cm. If the breadth of the rectangle is 30 cm, find its length. Also find the area of the rectangle. In each of the following groups, pick the substance that has the given property. Provide a BRIEF justification your answer.a. highest boiling point: CCl4 CF4 CBr4b. lowest freezing point: LiF F2 HClc. lowest vapor pressure at 25C: CH3OCH3 CH3CH2OH CH3CH2CH3d. greatest viscosity: H2S HF H2O2e. greatest enthalpy of vaporization: H2CO CH3CH3 CH4 f. smallest enthalpy of fusion: I2 CsBr CaO Identify two fiscal policies by which the federal governmentexerts control over state policy decisions the nurse finds it difficult to care for a patient whose advance directive states that no extraordinary resuscitation measures should be taken. which step may help the nurse to find resolution in this assignment? y= -1-3csc(pix/2+3pi/4)find domain, range, amplitude, period, zeros, and asymptotes FILL IN THE BLANK complete the sentence below by typing the correct response into the box. the language of informal speech is called________ true or false medieval statues were often freestanding and rarely attached to buildings as decorations question content area comprehensive problem 3 part 2: the following is a comprehensive problem which encompasses all of the elements learned in previous chapters. you can refer to the objectives for each chapter covered as a review of the concepts. note: you must complete part 1 before completing part 2. based on the following data, prepare a bank reconciliation for december of the current year: a. balance according to the bank statement at december 31, $283,000. b. balance according to the ledger at december 31, $245,410. c. checks outstanding at december 31, $68,540. d. deposit in transit, not recorded by bank, $29,500. e. bank debit memo for service charges, $750. f. a check for $12,700 in payment of an invoice was incorrectly recorded in the accounts as $12,000. kornett company bank reconciliation december 31, 20y5 balance according to bank statement $fill in the blank 2 add: deposit in transit on december 31 fill in the blank 4 deduct: outstanding checks fill in the blank 6 adjusted balance $fill in the blank 7 balance according to company's records $fill in the blank 9 deduct: bank service charges $fill in the blank 11 deduct: error in recording check fill in the blank 13 total deductions fill in the blank 14 adjusted balance $fill in the blank 15 examine the following survey question for any sources of bias. do you think high-school students should be required to wear uniforms? Which of the following is true according to the circular-flow diagram?A. Firms receive income from households.B. Households receive wages, rent, and profit from firms.C. Firms receive wages, rent, and profit from the government.D. Households receive revenue from the government. Don't make a noise. The baby...............(sleep).(put the verb in bracket in correct tense) WILL GIVE BRANLIEST !Case #28104Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.Part TwoCopy the DNA sequences for each suspect into a Word document.Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.Repeat step 1 with the DNA samples for Suspects B and C.Suspect ATCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGASuspect BTCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGASuspect CTTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGAProbeAGGTQuestionsAnswer these following questions in the essay box below.1. Which suspect most likely committed the robbery?2. How do you know? Determine if 2x = 14 + y and 4x + 2y = 10 are parallel, perpendicular, or neither. About ____ of the crude oil used by humans is derived from the seabed.a. 3/4b. 1/2c. 1/3d. all Choose the answer that is not correct. Anaerobic metabolism:__________. a. does not require oxygen. b. produces energy. c. is used predominantly for short-duration, high-intensity activity. d. is energy generator used when glycolysis is not possible. Please solve for x. x/16 = 9/2 synthesis of macromolecules such as starch, proteins, and dna are coupled to atp hydrolysis. however, one atp molecule can supply only a fraction of the energy needed to synthesize one of these macromolecules. which statement best describes how the small amount of energy provided by atp can be used to accomplish this synthesis demand? The dod's (department of defense) fire inspector course was orginally developed by the air force in 1967 and reduced fire loss across the air force by an estimated ____ percent over the next 10 years. -This group journeyed to the New World seeking religious freedom from the church of England. a) Pilgrims b) Puritans c) Quakers d) Debtors