How could you predict which bumper cars will win in a collision? Describe an experiment you could do that would help you know whether the weight, speed, or direction of the cars have the biggest effect on collision outcomes?

Answer:

glucose and oxygen are the products

Answer:

hope it helps

Explanation:

The products of photosynthesis are glucose and oxygen

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

Answer: sedimentary

Explanation:

Answer: Bacteria break down organic material in wastewater and form the floc that settles and separates solids from liquids. Controlling F/M ratio–a vital component to creating a favorable environment for wastewater bacteria–can be accomplished through the use of bioremediation products. Bacteria account for 95% of the microorganisms in wastewater. They are single-celled microorganisms that are classified based on their response to oxygen.

Aerobic bacteria use oxygen, which is added mechanically, to break down wastewater contaminants, converting it into energy. Bacteria use this energy to grow and reproduce. Anaerobic bacteria obtain oxygen from their food source. As anaerobic bacteria break down sludge, they produce methane gas. This methane gas can be used as an alternative energy source, called biogas, to fuel the wastewater treatment process. Anaerobic bacteria can also be used to lower the amount of phosphorus in the effluent. Although they prefer oxygen, facultative bacteria can switch between aerobic and anaerobic forms in response to their environment.

Answer:1. Research, education and monitoring

2. Recreation & tourism

3. Cultural values

Explanation:

When a person experiences a drowning incident and stops breathing, immediate intervention is necessary to provide oxygen to the brain and other vital organs to prevent permanent damage or death.

Traditionally, this intervention has been called "artificial respiration" or "mouth-to-mouth resuscitation," where a person provides breaths to the victim by blowing air into their mouth to mimic the process of respiration. However, the term "artificial respiration" can be misleading because the action performed during resuscitation is not a complete replacement of the biological process of respiration as it occurs naturally in a living organism. Instead, it is an external intervention to provide oxygen to the victim until they can resume normal breathing on their own.

A more accurate and biologically precise term for this intervention is "resuscitation" or "cardiopulmonary resuscitation" (CPR). Resuscitation involves a combination of chest compressions to maintain blood circulation and rescue breaths to provide oxygen to the victim. By using the term "resuscitation," biologists and medical professionals can better convey the concept that the goal is to restore the natural processes of breathing and circulation, rather than implying the creation of an entirely "artificial" biological function.

To know more about breathing:

https://brainly.com/question/32448379

#SPJ2

Answer:

The five senses collects informations from the surrounding and sends to the brain.

Explanation:

The brain through the help of the five senses helps a person to react to objects in their surroundings.

The five senses of touch sight, smell, hearing and taste all have their special sensors. These sensors are what picks messages from objects and sends to the brain. The brain then interprets the message received by the person from any of the senses.

Answer:

Biogenic and thermogenic

Explanation:

Biogenic and thermogenic are the two ways or mechanism that is responsible for formation of natural gas. Biogenic gas is formed with the help of methanogenic organisms that is present in marshes, bogs, landfills, and shallow sediments. Thermogenic gas is formed from organic matter that is buried in the deeper earth where the temperature and pressure are very high.

The organic pathway of the carbon cycle is the pathway in which carbon moves from atmosphere, through producers, herbivores and other organisms in the ecosystems, and converted back to the atmosphere.

In geological pathway, carbon moves from the atmosphere, through the ocean to rocks and the mantle, and then back to the atmosphere.

Symptoms of this condition include paralysis of the stomach muscles. Muscles are controlled by nerve impulses, therefore the most likely cause for this condition is (A.) damage to nerves that control the stomach

B. lack of pancreatic juices and bile -> this will lead to food not being chemically brokend down properly in the stomach and oils not mixing with water leading to malnutirion

C. Lack of enzymes in the small intestine -> this will also lead to food not being chemically digested and malnutrition

Answer:

Mammals

Explanation:

This is because the sperm meets the egg and fertilizes it in a female mammals which occurs in the ovary

Answer:

D. they can create deep valleys

Explanation:

Hope this helps ⭐

They can create deep valleys is true about folds.

The combined effects of gravity, water, and ice result in valleys, which are low-lying sections of land that have been eroded and washed out. Some are hollow, while others hang.

The majority of primary valley cuts are made by rivers and streams, creating sides with high walls and a narrow floor that from a distance resembles the letter "V." The steepness of the sides and the width of the floor are both influenced by the gradient of the river, or how quickly it descends.

Waters add to the land's natural twists as they move toward the sea by removing sediment from bends' exteriors.

Therefore, They can create deep valleys is true about folds.

To learn more about Deep valleys, refer to the link:

https://brainly.com/question/30333289

#SPJ6

Answer: dominant

Explanation:

Answer:

From my opinion it would be:

Temperature: Molecules, like practically everything else you can think of, tend to diffuse faster as temperature increases, as this increases the random collision between molecules and increases the rate of diffusion.

Explanation:

Answer: pathway intermediates are prevented from entering alternative metabolic pathways

Explanation: the clustering of enzymes in a metabolic pathway ensures that the product of one enzyme is efficiently transferred to the next enzyme in the pathway. So, the clustering prevents pathway intermediates from being diverted into alternative metabolic pathways.

The statement that best describes the most likely result of this clustering of enzymes is as follows:

Thus, the correct option for this question is A.

Enzymes may be defined as biocatalysts that increase the rate of a chemical reaction without being altered in the complete process. It is thought that all cellular reactions or processes are mediated by enzymes.

According to the context of this question, the process of assembling or clustering enzymes in any metabolic pathway makes sure that the outcome of one enzyme is operating as the reactant of the next enzyme in the same metabolic pathway.

So, the process of clustering effectively restricts the formation of intermediates and the regulation of alternative metabolic pathways.

Therefore, the correct option for this question is A.

To learn more about Enzymes, refer to the link:

https://brainly.com/question/1596855

#SPJ2

The gene that shows themselves are called dominant gene and the gene that less likely show themselves are called recessive gene. One of all the possible options for a given gene is allele.

Gene is defined as a section of DNA that encodes for a certain trait. An allele is defined as a variant form of a gene. It determines an organism's genotype. It determines an organism's phenotype.

There are two type of gene: Dominant gene and recessive gene

Dominant gene is expresses itself more strongly all by itself than any other version of the gene which the person is carrying.

A recessive gene is a gene whose effects are masked in the presence of a dominant gene. It doesn't show it self . Every organism that has DNA packed into chromosomes has two alleles, or forms of a gene, for each gene: one is inherited from their mother, and one is inherited from their father.

learn more about gene and allele from

https://brainly.com/question/3452155#

#SPJ1

The part of Pakicetus anatomy that most suggest it is an ancestor of whales is ears adapted partly for hearing underwater.

Pakicetus is an extinct early mammal believed to be closely related to the ancestral line of whales. One of the key pieces of evidence supporting this relationship is the structure of its ears. Pakicetus had specialized ear bones that show adaptations for hearing underwater.

The ear structure of Pakicetus contains a specialized bone known as the involucrum, which is similar to the ear bones found in modern whales. The involucrum is thickened and dense, indicating adaptations for underwater hearing. This adaptation suggests that Pakicetus and its descendants gradually transitioned to an aquatic lifestyle and relied on hearing underwater, a feature that is prominent in modern whales.

While other options, such as eyes near the top of the head and teeth consistent with a carnivorous diet, may also be present in whales, it is the presence of ears adapted for hearing underwater that provides strong evidence of the evolutionary link between Pakicetus and the ancestors of whales.

To learn more about anatomy click here

https://brainly.com/question/32013958

#SPJ11

According to the research, the correct option is Relative dating. It involves age-dating fossils with known time periods grouped into four eras that represent distinct ages in the history of earth.

It consists of ordering fossils or events in a proper formation sequence from the oldest to the most modern, it tends to be used as a method for making chronologies, the ordering of events, fossils or rocks.

Since it does not give an exact or approximate date, they can only give us a fairly long period of time, or in their case a temporal ordering of the fossils.

Therefore, we can conclude that according to the research,  the correct option is Relative dating. It involves age-dating fossils with known time periods grouped into four eras that represent distinct ages in the history of earth.

Learn more about Relative dating here: https://brainly.com/question/1557848

#SPJ1

Answer:

Explanation: Deoxyribonucleic acid is said to contain instructions for species characteristics because it carries the information that characterizes an individual.

DNA is made up of Nitrogenous bases that are unique codes specified by an individual and no two people have the same DNA.

Genes are genetic information or instruction that specify an individual. it is located in the chromosome in the nucleus. DNA contains a gene that helps to make molecules called proteins. It is the basis of all inheritance and the expression of the gene is what produces the phenotype that is visible.

Several lines of evidence from various fields of biology and genetics have led scientists to the conclusion that the instructions for species characteristics are carried in DNA.

To begin with, it has been discovered that the offspring of living organisms resemble their parents in many ways. This is true for traits like eye color, hair color, height, and many others. This observation implies that some kind of information or instructions must be passed down from generation to generation.

Second, research into inheritance patterns in plants and animals has revealed that certain traits are passed down in a predictable manner from generation to generation. This resulted in the development of Gregor Mendel's laws of inheritance in the nineteenth century, which established that genetic traits are carried on discrete units known as genes.

Third, using advanced microscopic techniques, scientists discovered that the nucleus of a cell, which contains the genetic material, is made up of thread-like structures known as chromosomes. Further research revealed that chromosomes were made of a chemical substance known as DNA (deoxyribonucleic acid).

Learn more about DNA: https://brainly.com/question/264225

Answer:

Sorry I can't understand anything

Answer:

Motor neuron

Explanation: is correct

the opening up of ecological niches that accompanied the extinction of the dinosaurs provided opportunities for rapid mammalian diversification. this is a good example of adaptive radiation.

When organisms wanted to take advantage of a niche but were unable to do so with their current body design or structural component, this marked the beginning of the point of evolution. In order to improve their chances of survival, organisms began to divide and develop new forms.

The evolutionary process by which numerous species radiate to other species from a single species in a region is known as adaptive radiation. Darwin was the first person to notice the adaptive radiation phenomenon when he went to Galapagos Island.

The rich mammal diversity that exists today was brought about by an adaptive radiation event caused by the global extermination of dinosaurs. Adaptive radiation in mammals followed five distinct limb structure lines:Arboreal: Squirrel, monkey, and other trees-adapted limbs (scansorial legs)

Know more about adaptive radiation here: https://brainly.com/question/1349313

#SPJ4

Answer:

Gravitropism

Step-by-step explanation

The growth of certain parts of plants that are respected by the force of gravity

The first digit of quotient is 7. As first three digits (365) can be divided by 47.

Quotients are the results of dividing two numbers, one by the other. We can take advantage of the fact that division can be seen as multiplication, but with the multiplicative inverse of the denominator.

A 4-digit number must be divided by a 2-digit number.

Place the dividend (3654) beneath the Place of the divisor (47).

The dividend's first two numbers may be (36). 36 cannot be divided by 47 to get a complete number because it is less than 47.

then subtract the dividend's first three digits (365). Seven 47s are contained in the number 365.

(7 x 47=329)

(8 x 47=376).

Place the 7 now directly above the 5 and above the division bracket, and we will get the solution to 77.

For more such questions on division , Refer:

https://brainly.com/question/28119824

#SPJ4

Answer:

Yes it does for example the science room has the materials to be safe during school.No because there is still the covi going on and some students aren't taking it seriously.One concerne that I have is that if they need help with their studies their should be tutoring

A characteristic that only appears in conjunction with one specific aneuploidy is known as syndrome. A syndrome turns into a disease when it is linked to a specific cause.

A syndrome is a group of related medical symptoms and signs that are frequently connected to a certain disease or disorder. Sometimes a syndrome and its aetiology or cause are so closely related that the terms syndrome, disease, and disorder are used to refer to them all. Medical diagnoses are sometimes misunderstood due to word substitution.

Aneuploidy is the occurrence of an abnormally high number of chromosomes in a cell, such as 45 or 47 chromosomes in a human cell as opposed to the typical 46. Chromosome segregation mistakes can go wrong in a number of ways, and these mistakes are what lead to aneuploidy.

the complete question is:

What is a syndrome?

A. a group of traits typically found in conjunction with a particular chromosomal aberration or gene mutation

B. a characteristic trait usually given the discoverer's name

C. a group of traits, all of which must be present if an aneuploidy is to be diagnosed

D. a characteristic facial appearance

E. a characteristic that only appears in conjunction with one specific aneuploidy

learn more about syndrome here

https://brainly.com/question/9782041

#SPJ4

The increased adoption of digital and mobile banking during the Covid-19 pandemic has highlighted the importance of these services in maintaining financial inclusion, accessibility, and convenience.

During the Covid-19 pandemic, the rapid increase in the use of digital and mobile banking applications was beneficial for both consumers and financial institutions. For consumers, digital and mobile banking allowed them to conduct financial transactions from the safety and comfort of their own homes, reducing the need for in-person visits to physical bank branches. This was particularly important during lockdowns and restrictions on movement. Additionally, digital and mobile banking applications offered increased convenience and flexibility, allowing consumers to manage their finances on-the-go, and access their accounts 24/7.

For financial institutions, the surge in digital and mobile banking usage allowed them to maintain essential services for customers while reducing the need for in-person interactions. This was particularly important for banks that had to temporarily close branches or reduce staffing levels due to Covid-19. Digital and mobile banking applications also helped banks to reduce costs associated with traditional brick-and-mortar operations.

During the COVID-19 pandemic, the rapid increase in the use of digital and mobile banking applications was beneficial for customers, financial institutions, and businesses. This shift facilitated safe, convenient, and contactless transactions, helping to minimize the risk of virus transmission and maintain essential financial services.

Learn more about Covid-19 pandemic here:-

https://brainly.com/question/30975256

#SPJ11