What is the correct meaning of the word perplexity?.

Answer:

Just answering for the points and ik this is so late.

Explanation:

Have a great day!

Lilac~

A nerve impulse will be recorded from a nerve cell whose membrane potential rises above the threshold of excitation. What is a nerve impulse  A nerve impulse is a sudden change in the potential difference across the nerve cell's plasma membrane that travels along the nerve fiber.

The generation and propagation of a nerve impulse are the fundamental mechanisms that enable communication between various parts of the body and the brain. Neurons, or nerve cells, are specialized cells that communicate with one another and other cells via electrical and chemical signals. The membrane potential is a measure of the electrical potential difference across the membrane of the nerve cell.

The threshold of excitation is the membrane potential level at which the nerve cell's membrane potential depolarizes, leading to the generation of a nerve impulse .A nerve impulse travels along the length of a nerve fiber when the membrane potential of a nerve cell rises above the threshold of excitation. A nerve impulse is an all-or-nothing event, meaning that it either occurs or does not occur depending on the level of membrane depolarization.

If the membrane potential of a nerve cell does not reach the threshold of excitation, a nerve impulse will not be generated, and communication between neurons will not occur. Hence, a nerve impulse will be recorded from a nerve cell whose membrane potential rises above the threshold of excitation.

To know more about plasma visit:

https://brainly.com/question/950535

#SPJ11

Answer:

it helps break down food

Explanation:

:)

Answer:

Diffusion in gases and liquids and Osmosis mainly in liquids through a semi permeable membrane

Answer:

Passive transport

Explanation:

This is transport that occurs without the use of energy.

Answer:

A cell

Explanation:

fundimental/basic structure

When chiasmata can first be seen in cells using a microscope, the following processes has most likely occurred in prophase I.

Recombination can occur at any two chromatids within this tetrad structure.

Crossovers between homologous chromatids can be visualized in structures known as chiasmata, which appear late in prophase I.

Thus, option "C" is correct, Prophase I.

To learn more about prophase I click here:

https://brainly.com/question/4137695

#SPJ1

The hierarchical arregment of life under organisms are classified is the following:

Biosphere

Ecosystem

Community

Population

Organism

Organ systems

Organs

Tissues

Cells

Organelles

Molecules

Atoms

If blood supply to an arm is cut off, the arm would become ischemic, which means that there would be no blood flow to the tissues in the arm, which could lead to tissue damage or death and after five minutes, the blood in the arm would have decreased oxygen levels, increased carbon dioxide levels, increased acidity, and decreased pH.

The correct option to the given question is option d.

If blood supply to an arm is cut off, the arm would become ischemic. The absence of blood supply means that the cells in the arm would not receive oxygen or nutrients, which are essential for cell function and survival.
After five minutes, if blood in the arm is sampled and analyzed, the following changes would be observed:
Decreased oxygen levels: Since blood is not flowing to the arm, oxygen levels in the blood would decrease. This would lead to hypoxia, which is the condition of not having enough oxygen to meet the body's needs.
Increased carbon dioxide levels: As oxygen levels decrease, carbon dioxide levels in the blood would increase. Carbon dioxide is a waste product of cellular metabolism, and it is normally carried away by the blood to be exhaled by the lungs. If blood flow is cut off to the arm, carbon dioxide would build up in the tissues.
Increased acidity: When cells are deprived of oxygen, they switch to anaerobic metabolism, which produces lactic acid. The accumulation of lactic acid in the tissues would lead to an increase in acidity.
Decreased pH: As a result of the increased acidity, the pH of the blood would decrease. pH is a measure of how acidic or alkaline a substance is. A lower pH indicates higher acidity.thus, correct option is d.

For more such questions on blood supply , visit:

https://brainly.com/question/21052830

#SPJ8

Answer:

grandgrandpa or grandgrandma

Explanation:

Answer:

Great grandpa or great grandma

Explanation:

Your parents parent is your grand—- so thier parents are your great grand ——

Answer: sperm.... egg.... zygote

Explanation: hope this helps

Answer: The sperm is the male sex cell.

The egg is the female sex cell.

A zygote forms as a result of fertilization.

Explanation:

Answer:

The answer is C, competition

Competition refers to the interaction between the organisms to seek or feed on the same resource.

The term that best describes the two predators living in the same habitat feeding on the same prey is competition.

Competition can be defined as:

Thus, the correct answer is Option C.

To know more about competition, refer to the following link:

https://brainly.com/question/1622043

Tracheophytes are vascular plants without seeds. While Ferns have vascular tissues like the xylem and phloem, they don't develop seeds or blooms to spread themselves. Option II is Correct.

Ferns, clubmosses, whisk ferns, and horsetails are a few examples of vascular plants without seeds. Pteridophyta is a class of vascular cryptogams that do not produce seeds but do possess vascular tissues for the conduction of water and minerals.

Selaginella and Salvinia are two examples. The earliest plants that evolve without circulatory tissue are non-vascular plants. Seedless vascular plants lack seeds but do contain vascular tissue. Gymnosperms lack blooms but do have seeds. Vascular tissue, seeds, and flowers are features of angiosperms.

Learn more about Ferns visit: brainly.com/question/800121

#SPJ4

Here is a summary of the short story "The Man to Send Rain Clouds" using the Somebody Wanted But So Then strategy:

Somebody: Teofilo, a respected elder in the Laguna Pueblo tribe, has died.

Wanted: His family and community want to honor him with a traditional funeral ceremony.

But: The priest, who is also a member of the community, refuses to participate in the ceremony because he believes it is pagan.

So: The family is forced to hold the funeral without the priest's blessing. They paint Teofilo's face with traditional symbols, offer him cornmeal and pollen, and pray for rain.

Then: The next day, it rains. The community is grateful to Teofilo for sending the rain, and they realize that they can still honor him even without the priest's blessing.

This story explores the conflict between traditional Pueblo beliefs and Christianity. It also shows how a community can come together to support each other during a time of loss.

Learn more about summary on

https://brainly.com/question/27029716

#SPJ1

The sequence of amino acids in a protein is determined by the sequence of nucleotides in the gene that codes for that protein. Genes are segments of DNA (deoxyribonucleic acid) that contain the instructions for building proteins.

The process begins with transcription, where DNA is transcribed into a complementary messenger RNA (mRNA) molecule. The mRNA then moves to the ribosomes, where translation takes place.

During translation, the mRNA sequence is read in sets of three nucleotides called codons. Each codon corresponds to a specific amino acid.

The sequence of codons in the mRNA determines the sequence of amino acids that will be assembled to form the protein. The genetic code, a universal code shared by all living organisms, specifies which codons code for which amino acids.

Therefore, the DNA sequence in the gene ultimately determines the sequence of amino acids in a protein, influencing its structure, function, and overall biological activity.

To know more about nucleotides refer here:

https://brainly.com/question/16308848#

#SPJ11

The minimum radiation dose required in order for Acute Radiation Syndrome (ARS) to occur is 0.5-1.0 Gy of radiation exposure.

Acute radiation syndrome (ARS) is a result of high doses of ionizing radiation exposure in a brief period of time. It is also called radiation poisoning or radiation sickness. Acute Radiation Syndrome (ARS), also known as radiation poisoning, is a group of symptoms that occur when the human body is exposed to ionizing radiation in high doses. The symptoms of acute radiation syndrome begin when a large amount of ionizing radiation is absorbed by the body in a short period of time, usually within hours or days of exposure.

The acute radiation syndrome is divided into three stages: the prodromal stage, the latent stage, and the manifest illness stage. The severity of the symptoms and how quickly they appear are determined by the amount of radiation exposure. The minimum radiation dose required in order for Acute Radiation Syndrome (ARS) to occur is 0.5-1.0 Gy of radiation exposure.

Learn more about Acute Radiation Syndrome:

https://brainly.com/question/32810003

#SPJ11

Explanation:

Because population increase the number of people so,their need will increase. Hence it can change to the physical or biological components of an ecosystem.

Answer:

Plants

Explanation:

In plant cells, the vacuoles are much larger than in animal cells

Answer:

B, because the relationship between an mRNA codon and its corresponding amino acid is called the genetic code. The three-nucleotide code means that there is a total of 64 possible combinations (4 3, with four different nucleotides possible at each of the three different positions within the codon)

Explanation:

Hope this helps

Answer: b I think

Explanation:

Answer:

The scientific theory is a well-tested, broad explanation of a natural phenomenon that we use in everyday life

Explanation:

Answer:

Scientific theory. A scientific theory is a well-tested, broad explanation of an aspect that can be repeatedly tested and verified in accordance with scientific method, using verified protocols of observation, measurement, and evaluation of the results. Where possible, theories are tested under controlled conditions in an experiment.  In everyday life, we often use the word theory to mean a hypothesis or educated guess, but a theory in the context of science is not simply a guess—it is an explanation based on extensive and repeated experimentation.

Explanation:

Examples include bones, teeth, shells, leaf impressions, nests, and footprints. This evidence reveals what our planet was like long ago. Fossils also show how animals changed over time and how they are related to one another.

Answer:

bones  plants and rocks

Explanation:

I'm not serten i'm sorry

Answer: b

Explanation: I'm pretty sure its correct because if a seed doesn't have moisture it wont be able to fertile.  

Answer:

Option B

Explanation:

I hope it is the right one

Answer:

We see more of the lighted side of the moon because it is growing, so we see more

The time it takes to go from new moon to full moon is 2 weeks, because it takes a whole month (4 weeks) to go from new moon to full moon to new moon

P.S. PLEASE give me Brainliest?

Random mutation is not an mechanism of evolution .

Five important factors for evolution mechanism are Natural Selection, genetic drift, gene flow, mutations, and non random mating. Through these process members of a population differs greatly in their traits.

Natural selection is the most important mechanism of evolution, other evolutionary mechanisms can also change the frequencies of traits in populations. These include mutation, genetic drift and migration. Natural selection have 5 basic and major components These are Variation (individual have variation in appearance and behavior ), Inheritance( traits are continuously passed on from parent to offspring), Selection, Time and Adaptation.

To learn more about Natural selection  , here

brainly.com/question/9830102

#SPJ1

One of the most impressive models of sustainable development can be seen in the Costa Rican zoned reserves, option (D) is correct.

Costa Rica has implemented a pioneering approach to conservation and sustainability by establishing a network of protected areas and zoned reserves. These reserves effectively manage and protect the country's diverse ecosystems, ensuring the preservation of biodiversity and natural resources.

By prioritizing conservation, Costa Rica has managed to strike a balance between economic development and environmental protection. The zoned reserves have become a successful model for sustainable tourism, attracting visitors while maintaining ecological integrity. The Costa Rican zoned reserves serve as an inspiring example of how sustainable development can be achieved by prioritizing the preservation of natural ecosystems, option (D) is correct.

To learn more about sustainable follow the link:

https://brainly.com/question/14681668

#SPJ4

The correct question is:

One of the most impressive models of sustainable development can be seen in the _____.

A) United States' national park system

B) use of petroleum products in Western countries

C) increasing popularity of organic farming

D) Costa Rican zoned reserves

E) growth of open lands programs sponsored by a variety of government entities

Answer:

have cells

use energy

reproduce

respond to the environment

grow and develop

Explanation:

edge

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

Answer:

Osmosis in animal cells. animal cells have partially permeable cell membrane.  animalcells are placed in pure water because their cytoplasm is a stronger solution than the pure water, water will pass into the cells by osmosis. The cells will therefore swell up.

Explanation:

Answer:

May you provide the more so I can answer you